1) FCCC13826_1838 ACAGGCCATAAGTGGATTGC 374 This study RCCC13826_1838 CCGTCATAGTGGGCTCTCAT — This study C. concisus zot gene (YP_001467422) FCCC13826_2075 TGCAAACCCTTTGTGATGAA 355 This study RCCC13826_2075 CATGAGCCAGCTCAATCAAC — This study Human interleukin 8 gene (NM_000584)
hIL-8f TTTTGCCAAGGAGTGCTAAAGA 194 PB b hIL-8r AACCCTCTGCACCCAGTTTTC — PB b Human C1orf33 gene (NM_016183) hC1orf33f TCCAAGCGCGACAAGAAAGT 102 PB b Selleckchem C59 wnt hC1orf33r GTAGGTGTCCACACATTTCCG — PB b C. jejuni CDT B gene (U51121) P5 GAATCCGTTGGCACTTGGAATTTGCAAGGC 495 [40] P6 GGATTCGTTAAAATCCCCTGCTATCATCCA — [40] a GenBank or NCBI protein accession number indicated in brackets. b Primers sequences were obtained from the PrimerBank database http://pga.mgh.harvard.edu/primerbank/index.html Amplified fragment length polymorphism analysis Campylobacter concisus
isolates were genotyped using the AFLP protocol described by Kokotovic and On [38]. Briefly, genomic DNA (125 ng) was digested with Cps6I (10 U) in Y+/Tango Buffer (MBI) for 1 h at 37°C. BglII (10 U) was then added, and digestion was continued for one additional hour. Restriction site-specific adaptors (Table 5) were then ligated to the digested fragments for 2 h at room temperature. PCR amplification of the ligation mixture (diluted 10-fold) was carried out using primers BGL2F-0 and CSP6I-A (Table 5) for 35 cycles with an annealing temperature of 54°C. The final products were separated with an ABI 3130 automated DNA sequencer (Applied Biosystems). To analyze AFLP profiles, fragments ranging from 75 to 500 bp and the 500LIZ Genescan molecular mass standard were imported and compared Protein Tyrosine Kinase inhibitor using the BioNumerics 4.01 software (Applied Maths, Kortrijk, Belgium). Relationship of AFLP profiles
(“”curves”") were inferred by use of the Pearson-product-moment correlation coefficient (applying 2% optimization) and clustered by the unweighted pair group with mathematical average (UPGMA) method. To ensure reproducibility, AFLP analysis was conducted twice for isolate, and one representative of each AFLP profile was used for cluster analysis. PCR for 23S rRNA, acetylcholine cpn60, CDT B, S-layer RTX, and zot genes Primers for PCR are listed in Table 5. PCR amplification of the 23S rRNA gene was conducted according to the method of Bastyns et al. [11], except that the two reverse primers (CON1 and CON2) were used independently rather than as a mixture. Isolates amplifying with either MUC1/CON1 or MUC1/CON2 primers were assigned to genomospecies A or B, respectively. Campylobacter concisus-specific nested-PCR amplification of the Smad2 signaling chaperonin gene (cpn60) was conducted using the primers Ccon-cpn_66f and Ccon_cpn_423r for 25 cycles with an annealing temperature of 53°C [35]. The resultant PCR product was used as a template for a second round of PCR with the nested primers Ccon_cpn_72f and Ccon_cpn_342r for 30 cycles with an annealing temperature of 53°C.