1 Server (http://www.cbs.dtu.dk/services/SignalP/) [62], (ii) a potential transmembrane segment following the C-terminal “LPXTG-like” sequence, as predicted by TMHMM Server v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM/) [63], and (iii) at least two consecutive basic FK228 residues (arginine or lysine) at the C-terminus [31–33]. Genetic manipulation A list of primers and E7080 clinical trial plasmids used in this study
can be found in Tables 4 and 5, respectively. The coding sequence for srtB (CD630_27180) was codon-optimized for expression in E. coli by Celtek Bioscience, LLC (Nashville, TN, USA). The resulting fragment was cloned into the NcoI/XhoI sites of pET28a using primers pET_3 and pET_4 to create pET28a-srtB. To improve soluble SrtB yield, the N-terminal transmembrane anchor domain (residues 2–25) was replaced with a six-histidine tag. The truncated gene srtB ΔN26 was amplified from pET28a-srtB buy CP673451 using primers pET_17 and pET_16,
and cloned into the NcoI/XhoI sites of pET28a to create pET28a-srtB ΔN26. The mutant protein SrtBΔN26,C209A was generated using the QuikChange Site-Directed Mutagenesis kit (Agilent) in accordance with the manufacturer’s instructions using pET28a-srtB ΔN26 as a template and primers C209A and C209A_antisense. Successful construction of recombinant plasmids was confirmed by DNA sequencing using primers T7F and T7R (Source Ketotifen BioScience). Table 4 Primers used in this study Primer Sequence pET_3 gatattccatggatgaagaaactgtaccgtatcgttatc pET_4 gatgagctcgaggatcagacgaccgtggataacc pET_17 gatataccatggatgcaccaccaccaccaccactctaaactgaccaaatacaaccacgacac pET_16 gatgagctcgagttagatcagacgaccgtggataac C209A tcgttaccctgtctaccgccacctacgaattcgacg C209A_antisense cgtcgaattcgtaggtggcggtagacagggtaacga T7F taatacgactcactataggg T7R gctagttattgctcagcgg Table 5 Plasmids used in this study Plasmid Description Reference pQE30Xa- srtB Codon optimized srtB, synthesized and cloned in pQE30xa Obtained from Celtek Bioscience, LLC
pET28a Commercial protein expression vector Provided by Neil Fairweather pET28a- srtB Codon optimized srtB cloned in pET28a This work pET28a- srtB ΔN26 srtB with residues 2–25 replaced with a six-histidine tag This work pET28a- srtB ΔN26,C209A Same as above, with C209A substitution This work RT-PCR analysis Total RNA was isolated from C. difficile 630 grown in BHIS at early exponential phase (t = 3 hours, OD600 = 0.4-0.5), late exponential phase (t = 5 hours, OD600 = 0.8-0.9), and stationary phase (t = 24 hours, OD600 = 0.6-0.8) using RNAprotect Bacteria Reagent (Qiagen) and the FastRNA Pro Blue Kit (MP Biomedicals LLC., Illkirch, France) in accordance with the manufacturer’s instructions. Genomic DNA was removed from total RNA samples using TURBO DNase (Life Technologies). Equal amounts of RNA were reverse transcribed into complementary DNA (cDNA) for expression analysis.