A major player in the regulation of Ca2+ transition from the ER to the mitochondria is the intracellular nonopioid sigma-1 receptor (S1R), a chaperone that modulates Ca2+ transition and cell survival under stress conditions by interaction with inositol 1,4,5-phosphate either receptors (IP3R) (32). S1R also binds cholesterol and sphingolipids, and this capacity determines its localization into detergent-resistant lipid rafts in the ER and MAMs (33) and its role in the redistribution of cellular lipids throughout intracellular compartments (34). Screening of a drug-like library for anti-HCV compounds revealed the antiviral activity of known S1R ligands (35). Thus, we set out to determine whether S1R plays a role in the HCV life cycle.
In the present study, we describe the discovery of S1R as a cellular factor that mediates early steps of viral RNA replication downstream of translation of the incoming viral genomes, suggesting that HCV uses elements of the MAMs as platforms for the initial steps of HCV RNA replication. MATERIALS AND METHODS Viruses and cells. JFH-1 and a cell culture-adapted JFH-1 variant, D183, viruses have been described previously (36, 37). Huh-7 (38) and Huh-7.5.1 (36) human hepatoma cells and HEK293T cells (39) were cultured in Dulbecco’s modified Eagle’s medium supplemented with 100 mM HEPES, nonessential amino acids (Gibco), penicillin/streptomycin (Gibco), and 10% fetal calf serum, as previously described (36). JFH-1-derived intergenotypic chimeric viruses were produced by electroporation of the in vitro-transcribed genomic RNA, as described previously (40).
Influenza A virus (A/WSN/33) was obtained from Juan Ort��n (Centro Nacional de Biotecnolog��a [CNB], Madrid, Spain). Vesicular stomatitis virus (Indiana) was obtained from the ATCC (Manassas, VA). Plasmids. JFH-1 cDNA was obtained from Apath (Brooklyn, NY). Mission short hairpin RNA (shRNA) plasmids pLKO-Puro and those expressing shRNAs targeting SIGMAR1 (S1R) were purchased from Sigma-Aldrich (St. Louis, MO). Control shRNA plasmid expressing a sequence from Thermotoga sp. was generated by insertion of the adaptor primer pair (5�� CCGGTAATTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTTTG and 5�� AATTCAAAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAATTA) immediately after the U6 promoter in the AgeI/EcoRI-digested pLKO-puro vector.
A similar strategy was used for insertion of the HCV internal ribosome entry site (IRES) targeting shRNA (41) using the primer pair 5�� CCGGTACCTCAAAGAAAAACCAAATTCAAGAGATTTGGTTTTTCTTTGAGGTTTTTTG and 5�� AATTCAAAAAACCTCAAAGAAAAACCAAATCTCTTGAATTTGGTTTTTCTTTGAGGTA. Plasmids necessary for vesicular stomatitis virus G protein (VSV-G)-pseudotyped lentivirus production, Drug_discovery pMDLg/pRRE (Addgene ID12251), pM2.G (Addgene ID12259), and pRSV-Rev (Addgene ID12253), were kindly provided by Didier Trono (Ecole Polytechnique Federale de Lausanne) (42).