Leflunomide advanced phase patients being treated with front line 2nd generation TKI had KD mutations

abl2F 5, tcatgacctacgggaacctc 3, and abl1R 5, atactccaaatgcccagacg , 3. PCR Erlotinib reactions were performed in a total volume of 25 Leflunomide clinical trial L containing 1 L first round PCR product, 0.2 U of High Fidelity DNA polymerase, 5× Phusion buffer, 2.5 mM MgCl2, 200 M dNTPs, and 0.5 M of each primer. The PCR profile was as follows, an initial denaturation at 98 for 30 s, amplification for 40 cycles at 98 for 10 s, 60 for 30 s, and 72 for 40 s with a final extension step at 72 for 5 min. The PCR products were run in 2% agarose gel by electropheresis and visualized by ethidium bromide. BCR ABL mutation screening by denaturing high performance liquid chromatography and DNA sequencing The 447 bp and 333 bp PCR products from nested RT PCR reactions were analyzed by DHPLC.
Prior to DHPLC analysis, mutant products were mixed with WT in a 1:1 ratio and denatured by heating at 95 for 5 min followed by gradual cooling at 1 /min to 25 within 70 min in order to allow heteroduplex and homoduplex formation. DNA were analyzed using a WAVE? nucleic acid fragment analysis system by Irinotecan structure injection of 5 to 10 L of each fragment onto a chromatography column and were then eluted at 59 with a linear acetonitrile gradient in 0.1 M triethylammonium acetate buffer at pH 7.0. The eluted cDNA was detected by 260 nm UV absorbance. For sequencing, the PCR products were purified using the Qiaquick PCR purification kit or ExoSAPIT ?, following the manufacturer,s protocol. Sequencing with forward and/or reverse primers in secondary PCR steps was carried out by the ABI3730XL DNA analyzer using ABI BigDye terminator cycle sequencing kits.
The generated Nelarabine solubility ABL fragments 1 and 2 encoding cover amino acid 206 428 of BCR ABL KD were sequenced. The results were compared with the ABL1 sequence. Nomenclature for new sequence variants was performed using the guideline from of the Human Genome Variation Society website. Novel mutations were determined using the mutation databases available at dbSNPdatabase, COSMIC, OMIM, and MoKCa. In addition, the predicted functional properties of newmutations or variations were determined through the Polyphen website based on physical and comparative considerations. The nucleotide position was based on the cDNA GenBank accession no. NM005157 and the sequence variations were described according to the HGVS system. Statistical analysis The Mann Whitney test was used to compare quantitative variables.
Comparison of qualitative variables was performed using a Fisher,s exact test and Chi square test. For all analyses, a p value of less than 0.05 kinship was considered statistically significant. Results Incidence of KD mutations in TKI exposed and TKI na?ve CML patients Of 171 samples, abnormal chromatogram patterns that were different from the WT profile were detected in 78 samples byDHPLC. Sequencing analysis confirmed the presence of KD mutations in 37 cases. About 23% of patients receiving first line imatinib, 69% of imatinib resistant patients receiving 2nd generation TKI, 75% of advanced phase patients being treated with front line 2nd generation TKI had KD mutations, and 8.75% of na?ve cases were found to carry the KD mutations. Among 80 TKIna?ve cases, 26 cases were exposed to hydroxyurea at a varying daily dosage of 500 1500 mg with a median drug exposure of 11 months.